Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_0000064 | |||
Gene | B4GALT2 | Organism | Human |
Genome Locus | chr1:44446997-44447136:- | Build | hg19 |
Disease | Lung Cancer | ICD-10 | Malignant neoplasm of bronchus and lung (C34) |
DBLink | Link to database | PMID | 29223555 |
Experimental Method | |||
Sample Type | Tissues and A549,H1299 Cell lines | Comparison | Tissue samples of lung cancer and paired normal tissues |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward AGCAGGCTGACAGTGGAGTT ReverseCAGCACATGCAGGAACAAAA | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Luo, YH, Zhu, XZ, Huang, KW, Zhang, Q, Fan, YX, Yan, PW, Wen, J (2017). Emerging roles of circular RNA hsa_circ_0000064 in the proliferation and metastasis of lung cancer. Biomed. Pharmacother., 96:892-898. |